We studied changes in electroencephalographic (EEG) oscillatory activity related to visual modulation of nociception, comparing cortical oscillations during innocuous or noxious contact heat, while participants viewed either their own hand or a neutral object at the same location. Viewing the body compared with viewing the object

reduced the intensity ratings of noxious stimuli, but not of innocuous heat. Time–frequency analysis of EEG data revealed that noxious, as opposed to warm, stimulation was associated with reduced beta (15–25 Hz) power. Classically, such decreases in oscillatory power indicate increases in sensory cortical activation. These event-related oscillatory changes were moreover modulated by the visual context; viewing one’s own body increased noxious Afatinib order stimulation-induced beta oscillatory activity bilaterally, relative to viewing a neutral object, possibly indicating inhibition of cortical nociceptive processing. These results demonstrate that

visual–nociceptive interactions involve changes in sensorimotor EEG rhythms. “
“The antineoplastic agent paclitaxel causes a dose-limiting distal, symmetrical, sensory peripheral neuropathy that DAPT ic50 is often accompanied by a neuropathic pain syndrome. In a low-dose model of paclitaxel-evoked painful peripheral neuropathy in the rat, we have shown that the drug causes degeneration of intraepidermal nerve fibers (IENFs), i.e. the fibers which give rise to the sensory afferent’s terminal receptor arbor. However, we

did not find any evidence for axonal degeneration in samples taken at the mid-nerve level. Here we aimed to determine whether the absence of degenerating peripheral nerve axons was due to sampling a level that was too proximal. Resveratrol We used electron microscopy to study the distal-most branches of the nerves innervating the hind paw glabrous skin of normal and paclitaxel-treated rats. We confirmed that we sampled at a time when IENF degeneration was prominent. Because degeneration might be easier to detect with higher paclitaxel doses, we examined a four-fold cumulative dose range (8–32 mg/kg). We found no evidence of degeneration in the superficial subepidermal axon bundles (sSAB) that are located just a few microns below the epidermal basal lamina. Specifically, for all three dose groups there was no change in the number of sSAB per millimeter of epidermal border, no change in the number of axons per sSAB and no change in the diameter of sSAB axons. We conclude that paclitaxel produces a novel type of lesion that is restricted to the afferent axon’s terminal arbor; we name this lesion ‘terminal arbor degeneration’. “
“This study aimed to evaluate the long-term consequences of early motor training on the muscle phenotype and motor output of middle-aged C57BL/6J mice. Neonatal mice were subjected to a variety of motor training procedures, for 3 weeks during the period of acquisition of locomotion.

05). Increased total hypoglycaemia was associated with increased duration of nasogastric feeding (p=0.016). Hypoglycaemia was prevalent before the next medication dose find more and rare between medication administration and feed bolus: 34.8% and 4.3% of hypoglycaemic patients respectively. It was not possible to assess the impact of withheld feeds from available documentation. Frequencies of hypoglycaemia, severe hypoglycaemia and extended hypoglycaemia are shown in Table

3. Sulphonylurea treatment (SU) was associated with increased incidence of hypoglycaemia (p<0.001) and extended hypoglycaemia (p=0.038). All hypoglycaemic patients had increased BGM post-hypoglycaemia (6.1±1.6/day) and based on this 78% had medication decreased

in response to hypoglycaemia. Survival analysis showed a significantly longer time to a subsequent hypoglycaemic episode between patients whose treatment was reduced in response to hypoglycaemia and those whose treatment remained unchanged (p=0.008) (see Figure 1). There was no association with subsequent hyperglycaemia (p=0.33). Hypoglycaemic episodes were not uncommon in these patients. Comparison with other nasogastric studies is difficult due to lack of quantification of hypoglycaemic events.15 Rates of hypoglycaemia in this study (PPD 10.9%; PTG 3.5%) were higher than the two comparable studies (PPD – not reported8 and 1.1–1.3%9; PTG – 1.4–5.48 and 1.1–1.39), especially as both defined hypoglycaemia as <3.9mmol/L; the higher cut-off point would be expected to identify more hypoglycaemic episodes.16 Frequency of BGM selleck kinase inhibitor also varied from 6.1±1.6/day (this study) compared to 4/day,8 and 4/day+ (maximum 6/day).9 However,

it has been shown that increased BGM can increase documented inpatient hypoglycaemia and severe hypoglycaemia.17 Additionally, one study9 included subjects on dual oral and enteral feeding which may tend to decrease frequency of hypoglycaemia.6,18 Severe and extended hypoglycaemia are not quantified in the literature on nasogastric feeding but the high frequency of BGM in our study may have increased documentation of these.17 Hypoglycaemia and extended hypoglycaemia were statistically associated with SU, consistent with other reports www.selleck.co.jp/products/erlotinib.html documenting increased frequency of hypoglycaemia in SU treated individuals, especially those >65 years of age.19,20 As this was a retrospective observational study, duration of nasogastric feeding varied. We therefore used Kaplan-Meier survival curves for time to event analysis of the effect of reduction in medication post-hypoglycaemia on a subsequent hypoglycaemic episode. This meant that censored data which arose from cessation of nasogastric feeding before a subsequent hypoglycaemic event was observed, were taken into account. As a consequence, we have shown a significantly increased time to a subsequent hypoglycaemic event in those whose medication was reduced.

Both drugs have also been shown to reduce CSF CMV-DNA load. Correcting the profound immunodeficiency by commencing or optimizing HAART is critical in management although no specific data exist for CMV disease of the nervous system. Optimal duration of treatment for both conditions remains uncertain. Prophylaxis against CMV encephalitis/polyradiculitis is not required but HAART is likely to decrease the incidence of these conditions (category IV recommendation).

There have been no prospective controlled trials for CMV neurological disease and, although well-designed randomized controlled CAL-101 purchase trials on the prophylactic efficacy of aciclovir (not effective), valaciclovir, ganciclovir, and valganciclovir (all effective) exist for CMV retinitis, the results of these cannot be extrapolated to encephalitis [125–127]. Given that HAART has been demonstrated to reduce

the risk of CMV end-organ disease and that this is a complication rarely seen where the CD4 is >50 cells/μL, the key to preventing encephalitis is initiation of ARV drugs according to national and international treatment guidelines selleck screening library [128]. Although good information is available to suggest maintenance therapy can be discontinued for CMV retinitis with immune recovery and a sustained rise in CD4 >100 cells/μL, no such evidence exists for neurological disease and a more cautious approach is advised. This decision should be based upon clinical, CSF and blood CMV-DNA levels, and imaging improvement. HAART decreases the incidence of CMV retinitis and CMV disease in general but specific data for encephalitis do not exist. Although CMV IRIS is reported in other settings, there are limited data on its presentation as a neurological disease at

this time. Abbreviations: PML, progressive multifocal leukoencephalopathy; PCNSL, primary central nervous system lymphoma; NHL, non-Hodgkin’s lymphoma; KS, Kaposi’s sarcoma; CT, L-NAME HCl computed tomography; MRI, magnetic resonance imaging; CRAG, cryptococcal antigen; TB, tuberculosis; ICP, intracranial pressure. “
“Following resolution of hepatitis C virus (HCV) infection, recurrence has been shown to occur in some persons with repeated exposure to HCV. We aimed to investigate the rate and factors associated with HCV RNA recurrence among HIV-1-infected patients with prior spontaneous HCV RNA clearance in the EuroSIDA cohort. All HIV-infected patients with documented prior spontaneous HCV clearance, and at least one subsequently collected plasma sample, were examined. The last sample was tested for HCV RNA and those with HCV RNA ≥ 615 IU/mL were defined as having HCV recurrence and their characteristics were compared with those of patients who were still aviraemic. Logistic regression was used to identify factors associated with HCV recurrence. Of 191 eligible patients, 35 [18.3%; 95% confidence interval (CI) 12.8–23.8%] had HCV recurrence. Thirty-three (94.3%) were injecting drug users (IDUs).

Moreover, to expand our knowledge on virulence plasmid diversity, in this study, we also report the nucleotide sequence of the second most frequently isolated vapA-carrying plasmid type: an 87-kb type I plasmid. In this study, we used a total of 96 R. equi field strains, comprising 61 clinical strains isolated from horses that had been autopsied in Normandy (France) from 1995 to 2006 and whose death had been caused by R. equi, 22 strains isolated from organic samples collected at horse-breeding farms (faeces, straw and manure) and 13

environmental strains isolated from horse-breeding farm environments Copanlisib cost (water, soil and dust). For more details, see Supporting Information, Table S1. Field strains were identified as R. equi based on colony morphology, API Coryne (bioMérieux, France) biochemical profiling and a synergistic haemolysis (CAMP-like) test with Listeria ivanovii (Navas et al., 2001). The bacteria were grown for 24 h at 37 °C using brain–heart infusion (BHI) broth (BD-Difco) as the base medium, supplemented with 1.5% agar for plate cultures. Plasmid DNA was isolated from R. equi using the alkaline lysis method (Sambrook et al., 1989) with the following modifications: R. equi strains were grown for 24 h at 37 °C in 20 mL of BHI broth (BD-Difco). Ten millilitres of bacterial cultures were centrifuged, and the bacterial pellet was washed in 5 mL of 0.5 M Tris-HCl (pH

Androgen Receptor Antagonist manufacturer 8.0). After centrifugation, pellets were resuspended in 200 μL of a freshly prepared solution containing 0.025 M Tris-HCl (pH 8.0), 0.01 M EDTA (pH 8.0) and 0.05 M glucose, plus 20 mg mL−1 lysozyme.

The bacteria were incubated at 37 °C for 1 h. Cells were then lysed by adding 400 μL of a solution containing 1.0% w/v sodium dodecyl sulphate and 0.2 M NaOH. Chromosomal DNA was precipitated Megestrol Acetate with 5 M potassium acetate acetic acid buffer (pH 4.8) and centrifuged at 13 000 g for 5 min. Then, supernatants were transferred to MaXtract high-density gel barrier tubes (Qiagen), and an additional phenol–chloroform extraction, followed by chloroform extraction, was carried out according to the manufacturer’s instructions. Plasmid DNA was digested with BamHI, EcoRI and HindIII endonucleases to generate RFLP profiles. DNA fragments were separated by electrophoresis in 0.7% agarose gels at approximately 5 V cm−1 for 2 h, and visualized using ethidium bromide under UV transilluminator. All chemicals were purchased from Sigma-Aldrich unless stated otherwise. Plasmid sequencing was performed by Qiagen Sequencing Services, Germany (>99.99% accuracy). The sequence of pVAPA116 was submitted to the GenBank™/EMBL data base (accession number HM114217). The sequence of pVAPA116 was compared with that of other plasmids using tblastx (Abbott et al., 2005) and comparisons were visualized with the Artemis comparison tool (ACT) (Carver et al., 2005). Identification of horizontally acquired DNA was performed using the Alien Hunter algorithm(http://www.sanger.ac.

Moreover, to expand our knowledge on virulence plasmid diversity, in this study, we also report the nucleotide sequence of the second most frequently isolated vapA-carrying plasmid type: an 87-kb type I plasmid. In this study, we used a total of 96 R. equi field strains, comprising 61 clinical strains isolated from horses that had been autopsied in Normandy (France) from 1995 to 2006 and whose death had been caused by R. equi, 22 strains isolated from organic samples collected at horse-breeding farms (faeces, straw and manure) and 13

environmental strains isolated from horse-breeding farm environments PLX3397 chemical structure (water, soil and dust). For more details, see Supporting Information, Table S1. Field strains were identified as R. equi based on colony morphology, API Coryne (bioMérieux, France) biochemical profiling and a synergistic haemolysis (CAMP-like) test with Listeria ivanovii (Navas et al., 2001). The bacteria were grown for 24 h at 37 °C using brain–heart infusion (BHI) broth (BD-Difco) as the base medium, supplemented with 1.5% agar for plate cultures. Plasmid DNA was isolated from R. equi using the alkaline lysis method (Sambrook et al., 1989) with the following modifications: R. equi strains were grown for 24 h at 37 °C in 20 mL of BHI broth (BD-Difco). Ten millilitres of bacterial cultures were centrifuged, and the bacterial pellet was washed in 5 mL of 0.5 M Tris-HCl (pH

Bleomycin cost 8.0). After centrifugation, pellets were resuspended in 200 μL of a freshly prepared solution containing 0.025 M Tris-HCl (pH 8.0), 0.01 M EDTA (pH 8.0) and 0.05 M glucose, plus 20 mg mL−1 lysozyme.

The bacteria were incubated at 37 °C for 1 h. Cells were then lysed by adding 400 μL of a solution containing 1.0% w/v sodium dodecyl sulphate and 0.2 M NaOH. Chromosomal DNA was precipitated mafosfamide with 5 M potassium acetate acetic acid buffer (pH 4.8) and centrifuged at 13 000 g for 5 min. Then, supernatants were transferred to MaXtract high-density gel barrier tubes (Qiagen), and an additional phenol–chloroform extraction, followed by chloroform extraction, was carried out according to the manufacturer’s instructions. Plasmid DNA was digested with BamHI, EcoRI and HindIII endonucleases to generate RFLP profiles. DNA fragments were separated by electrophoresis in 0.7% agarose gels at approximately 5 V cm−1 for 2 h, and visualized using ethidium bromide under UV transilluminator. All chemicals were purchased from Sigma-Aldrich unless stated otherwise. Plasmid sequencing was performed by Qiagen Sequencing Services, Germany (>99.99% accuracy). The sequence of pVAPA116 was submitted to the GenBank™/EMBL data base (accession number HM114217). The sequence of pVAPA116 was compared with that of other plasmids using tblastx (Abbott et al., 2005) and comparisons were visualized with the Artemis comparison tool (ACT) (Carver et al., 2005). Identification of horizontally acquired DNA was performed using the Alien Hunter algorithm(http://www.sanger.ac.

Natural and recombinant Alt a 1 proteins share secondary structure and IgE-binding determinants and skin testing shows a similar reactivity. These results confirm that rAlt a 1 could be an effective candidate for the development of diagnostic and therapeutic approaches and that Y. lipolytica has become an attractive host for the expression of complex proteins such allergens. The authors thank Dr A. R. Viguera (Unidad de Biofísica, Universidad del País Vasco-CSIC, Leioa, Spain) for CD spectra analysis. J.A.A. is employee RG7204 clinical trial of the biopharmaceutical company Bial-Arístegui. “
“Isoprenoids are a large, diverse group of secondary metabolites which has recently raised a renewed research

interest due to genetic engineering advances, allowing specific Regorafenib order isoprenoids to be produced and characterized in heterologous hosts. Many researches on metabolic engineering of heterologous hosts for increased isoprenoid production are focussed on Escherichia coli and yeasts. E. coli, as most prokaryotes, use the 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway for isoprenoid production. Yeasts on the other hand, use the mevalonate pathway which is commonly found in eukaryotes. However, Lactococcus lactis is an attractive alternative

host for heterologous isoprenoid production. Apart from being food-grade, this Gram-positive prokaryote uses the mevalonate pathway for isoprenoid production instead of the MEP pathway. Previous studies have shown that L. lactis is able to produce sesquiterpenes through heterologous expression of plant sesquiterpene synthases. In this work, we analysed the gene expression of the lactococcal mevalonate pathway through RT-qPCR to successfully engineer L. lactis as an efficient host for isoprenoid production. We then overexpressed the mvk gene singly or co-expressed with the mvaA gene as an attempt Phospholipase D1 to increase β-sesquiphellandrene production in L. lactis. It was observed that co-expression of mvk with mvaA doubled the amount of β-sesquiphellandrene produced. “
“Myxopyronin B (MyxB) binds to the switch region

of RNA polymerase (RNAP) and inhibits transcriptional initiation. To evaluate the potential development of MyxB as a novel class of antibiotic, we characterized the antimicrobial activity of MyxB against Staphylococcus aureus. Spontaneous MyxB resistance in S. aureus occurred at a frequency of 8 × 10−8, similar to that of rifampin. The MyxB-resistant mutants were found to be altered in single amino acid residues in the RNAP subunits that form the MyxB-binding site. In the presence of human serum albumin, the MyxB minimum inhibitory concentration against S. aureus increased drastically (≥128-fold) and 99.5% of MyxB was protein bound. Because of the high serum protein binding and resistance rate, we conclude that MyxB is not a viable starting point for antibiotic development.

Seventy-three control participants were recruited from the local community. Both groups differed with respect to age, gender and marital status (P < 0.001), while education and socio-economic levels were similar. Pictilisib HRQoL was assessed using the Short Form-36 (SF-36) and depressive symptoms were assessed using the Patient Health Questionnaire-9 (PHQ-9). A multivariate analysis of covariance found that RA patients reported substantially higher depressive symptoms and lower HRQoL than healthy controls (P < 0.01 and P < 0.05, respectively). The effect sizes

of the differences between patients and controls in HRQoL and depressive symptoms were all large. All SF-36 HRQoL variables were significantly correlated with depressive symptoms in patients and controls (P < 0.05). PLX4032 Social functioning and vitality were uniquely associated with depressive symptoms in the RA group (P < 0.01 and P < 0.05, respectively), whereas education and social functioning were uniquely associated with depressive symptoms in controls (P < 0.05 and P < 0.005, respectively). Research indicates that individuals with RA have deteriorated HRQoL, and this study extends these findings to a Colombian sample and highlights the importance of the independent

relationship between depressive symptoms and vitality in this group of Colombians with RA. “
“The concept of a pharmacist/advanced practice nurse (APN)-led Rheumatology Monitoring Clinic (RMC) is a novel service in Singapore; we therefore conducted a questionnaire survey of patient experience. Patients attending the RMC were provided with a set of questionnaires. As a substudy, a separate questionnaire was given to the rheumatologists and therapists conducting the RMC. Of the 105 patients surveyed, a total of 97 (92.4%) patients were satisfied/strongly satisfied with the overall service, and none were dissatisfied; 96% felt that the pharmacists/APNs provided clear, detailed information about Leukotriene-A4 hydrolase their disease and medication, while 92% of patients were confident they knew what side-effects were possible. Ninety-two percent and 93% of patients were more likely to adhere to treatment,

and were willing to come back for follow-up at the RMC, respectively. There was no difference in patient satisfaction in the average Likert summed scores, between the pharmacists and APNs. Age, gender, ethnicity and underlying disease did not exert any influence on the responses. All the rheumatologists surveyed were satisfied with the patients’ management and the professionalism of the therapists. They opined that the RMC freed up time for them to see more complex cases. All the pharmacists/APNs concurred that the referrals were appropriately selected. We established the acceptability of a non-physician-led clinic in our local setting and highlighted the usefulness of having a routine clinic for monitoring medication toxicity and patient education.

Low-level (<10 000 copies/mL) episodes of viral failure appeared to have a small selleck chemical and temporary impact on subsequent CD4 cell counts. However, periods of viral failure >10 000 copies/mL were associated with a substantial reduction in subsequent

CD4 cell counts. The most dramatic impact of viral failure was on CD4 cell counts measured within 6 weeks of viral failure but, even up to a year after a viral load >10 000 copies/mL, geometric mean CD4 cell counts were lower in patients who had previously experienced viral failure. Effects of treatment interruption on subsequent CD4 cell counts appeared largely explained by virological failure. Among patients with baseline CD4 counts ≥500 cells/μL and at least one viral load >1000 copies/mL, CD4 counts declined between 4 and 8 years of follow-up (ratio of geometric means 0.86; 95% CI 0.78–0.93). In contrast, CD4 cell counts increased over the same period among those who did not experience virological failure (ratio of geometric means 1.11; 95% CI 1.05–1.16). check details Because

of this contrast, and because random-effects models account for drop-out when this is predictable from observed CD4 cell counts, we do not think that this decline is likely to be explained by loss to follow-up. A plausible explanation for these findings is that some patients discontinue treatment because they feel that their CD4 cell counts are sufficiently high. In particular, women with high CD4 cell counts who are

treated in order to prevent mother-to-child transmission may discontinue treatment after giving birth: unpublished analyses of data from this cohort suggest that higher rates of treatment discontinuation in women than in men are less pronounced after excluding pregnant women, and others have reported similar findings [21,22]. Interestingly, our estimates of the impact of Leukotriene-A4 hydrolase a higher viral load on subsequent CD4 increases did not depend substantially on whether treatment had been maintained or discontinued (permanently or temporarily), suggesting that viral replication has a similar impact on the immune system, whether or not treatment is still being taken. Our data collection tool does not collect information on all complete breaks (i.e. no drugs) in treatment of <2 weeks, which may mean that we underestimate the impact of treatment discontinuation on our estimates of the effects of virological failure on subsequent CD4 cell count increases. Several studies of trends in post-cART CD4 cell counts according to baseline CD4 cell counts have reported more than 4 years of follow-up among patients maintaining low viral loads. Of these, two reported increases in CD4 cell counts beyond 5 years of treatment in all baseline CD4 cell count groups [16,23].

Some functional genes have been disrupted through the insertion of ISs, preferentially IS231C. By comparing the Southern hybridization profiles of different B. thuringiensis strains, the existence of ISBth166 was mainly found in serovar kurstaki and the recent expansion of IS231C between different kurstaki isolates was suggested. In addition to revealing the ISs profile in YBT-1520 as well as the comparison in the B. cereus group, this study will contribute to further comparative

analyses of multiple B. thuringiensis strains aimed at understanding the IS-mediated genomic rearrangements among them. The Bacillus cereus group consists of a group of gram-positive endospore-forming bacteria belonging to the Firmicutes phylum. mTOR inhibitor These species have a huge impact on human activities due to their pathogenic properties and/or economic importance, such as Bacillus anthracis, the causal agent of anthrax, which can be lethal to humans and other mammals; B. cereus, an opportunistic human pathogen involved in food-poisoning incidents and contaminations in hospitals (Drobniewski,

1993); and Bacillus thuringiensis, an insect pathogen that is widely used as a leading biorational pesticide (Schnepf et al., 1998). These three species are very closely related at the genomic level and were strongly suggested to represent one species on the basis of genetic evidence (Rasko et al., 2005; Tourasse et al., 2006). The only established difference between B. cereus and B. thuringiensis strains is the presence of genes coding for the insecticidal toxins, usually check details present on plasmids (Helgason et al., 2000). Eighteen B. cereus group genomes have been completely sequenced and published in GenBank. Insertion sequences (ISs) are small transposable DNA fragments consisting of, in general, a unique transposase-encoding gene and terminal inverted repeats (IRs), which serve as the sites TCL for recognition and cleavage by transposases (Tpases) (Mahillon & Chandler, 1998). A large number of ISs have been

classified into 22 families mainly based on the amino acid sequence similarities of their Tpases (Siguier et al., 2006a). ISs played an important role in genome reshuffling and evolution by facilitating horizontal gene transfer and mediating homologous recombination between multiple copies present in a given genome (Mahillon et al., 1999). The diversity and distribution of some well-known ISs that are generally structurally associated with genes coding for parasporal crystal proteins in B. thuringiensis have been widely studied (Mahillon et al., 1994; Leonard et al., 1997; Rosso & Delecluse, 1997; Joung & Cote, 2003; Huang et al., 2004). However, the entire ISs content of the B. thuringiensis genome has never been reported. Bacillus thuringiensis ssp.

Polyclonal antiserum against the M. oxyfera and NirS enzyme was raised by injecting rabbits with two synthetic peptides: peptide 1 (amino acid position 139–153: PPDKRPTKPEHNRDW) and peptide

2 (amino acid position 520–534: EKARIDDPRIITPTG). Prior to the immunization, an extra amino-terminal cysteine was added to the peptide sequences for the conjugation to the Keyhole limpet haemocyanin (Eurogentec, Belgium). For the M. oxyfera pMMO enzyme, two polyclonal antisera learn more targeting α-subunit (pMmoB) were raised. α-pMmoB1 was raised by injection of rabbits with two synthetic peptides: peptide 1 (amino acid position 257–271: QTGRMDTPELKPTTE) and peptide 2 (amino acid position 324–337: DPALFPDSRLKIKVE). Prior to the immunization, an extra amino-terminal GSK1120212 cost cysteine was added to the peptide sequences for the conjugation to the Keyhole limpet haemocyanin (Eurogentec). α-pMmoB2 was generated from a heterologously expressed and purified fragment of pmoB in Escherichia coli as described previously (Harhangi et al., 2002), with the following modifications. Two primers were designed on the pmoB sequence; a forward primer on nucleotide position 790 (CCCGAACTGAAGCCCACGACAGAG) and a reverse primer on nucleotide position 1188 (GCCGCCGACCTCAACAATTTGTCTG). A stop codon

(TAA) was included in the reverse primer so as to express only an N-terminal His-tag. For directional cloning, restriction sites EcoRI and NotI were included in the forward primer and XhoI in the reverse primer. An additional nucleotide (T) was added between EcoRI and NotI so as to bring the sequence in frame. pET-30a(+) (Novagen, Germany) was used as the expression vector. Rosetta cells (Novagen) were used as the expression host. The heterologously expressed protein fragment (amino acid position 264–396) was purified using the HIS-Select® HF nickel affinity gel column (Sigma, The Netherlands) under denaturing conditions using the protocol Parvulin provided by the manufacturer. The identity of the expressed protein fragment was verified by MALDI-TOF MS peptide mass fingerprinting of a tryptic digest of the purified

protein fragment (Harhangi et al., 2002). For each antiserum, two rabbits were immunized using a 3-month immunization protocol. The antisera from both rabbits were pooled and affinity-purified (Eurogentec). The affinity-purified antisera (α-NirS, α-pMmoB1 and α-pMmoB2) were used as the primary antisera in immunoblot analysis and immunogold localization as described later. Approximately 2 g of cells (wet weight) was taken from the M. oxyfera enrichment culture. The cells were washed three times with 20 mM phosphate buffer pH 8.0 and resuspended in a medium containing 20 mM sodium phosphate and 50 mM sodium pyrophosphate pH 8.0. Cells were broken by sonication. Cell debris was removed by centrifugation (6000 g, 15 min, 4 °C), and the supernatant was collected as whole-cell extract.