Plates were incubated for 8 hours at 30°C. Thin layer chromatography (TLC) of AHLs Respective amounts GDC-0994 supplier of samples were spotted on C18 reversed-phase TLC-Plates (Merck, Darmstadt, Germany) and dried with a cold air fan. The chromatography was processed in a chamber filled up to 1 cm with a mixture of methanol and water (60:40 v/v). After the solvent was 1 cm from the top of the plate, the plate was taken out and the solvent was allowed

to evaporate. The dry plates were placed in petri-dishes and covered with top agar containing the indicator strain A. tumefaciens NTL4 as described above. Analysis of mRNA levels Cell samples were directly treated with RNA protect (RNA protect Bacteria Reagent, Quiagen, Hilden, Germany). RNA was isolated according to the NucleoSpin RNA II protocol from Macherey-Nagel (5.3 Support protocol NucleoSpin RNA II, Machery-Nagel, Düren, Germany) and stored at −80°C. For cDNA synthesis of the target genes, 500 ng total RNA of each sample was transcribed applying

the reverse primers (for primer sequences see Additional file 1: Table S1). Each primer contained a 20 bp match to the target gene. The reverse transcriptase step was performed in triplicates (RevertAidTM H Minus M-MuLV Reverse Transcriptase, Thermo Fisher Scientific, Vilnius, Lithuania). RNA was tested for DNA contamination prior to cDNA synthesis by using the total RNA isolate as template for the real time PCR. Real time PCR of the pooled cDNA preparations was conducted using the SYBR® Green PCR master mix from Life Technologies (SYBR Green 1 Dye, AmpliTaq Gold® DNA Polymerase, Life Technologies, Selleck MI-503 Carlsbad, USA). The gene encoding 16S rRNA (Rru_AR0004) with the primer pair Fwd: AGGTGACACTATAGAATATACGGGAGGCAGCAGTGGGG, Rev: GTACGACTCACTATA GGGATCACTCACGCGGCATGGCTG) was used as housekeeping gene which proved to be constant at all tested cultivation conditions. All real time PCR data were obtained from 5 biological replicas (cultivations) under Resveratrol aerobic, microaerobic and phototrophic

conditions, respectively. From each cultivation, 3 × 250 ng total RNA were amplified using specific primers. The three resulting cDNA molecules/sample were pooled and 3x determined by real time PCR. mRNA amounts were estimated using the experimentally determined efficiencies according to Pfaffl et al.[20]. Cluster analysis Cluster analysis was performed using the open source software PermutMatrix version 1.9.3 [21]. For this purpose data sets were first processed by Z normalization. Dissimilarity between the data sets was calculated applying the Pearson Distance, which calculates the correlation of a linear relationship of two variables. Once the calculated residual errors were taken into Selleck CYT387 account, the data set was then hierarchically clustered applying the Wards minimum variance criterion [22]. According to this method pairs were merged in clusters such that the total error within a group was minimized.