Construction and characterization of a flp1-3 mutant of strain 35000HP An unmarked, in frame deletion mutant of the flp1, flp2, and flp3 genes was made in H. ducreyi strain 35000HP using Flippase (FLP) recombinase technology as described previously [8, 9]. Briefly, two 70 bp primers, P1 and P2, were designed for construction of a cassette (Table 2). The 3′ end of each of these primers contained 20 bp complementary to regions 5′ CAL-101 price and 3′ of a spectinomycin

cassette flanked by FLP Recognition Target (FRT) sites in pRSM2832 [8]. The 5′ portion of the P1 and P2 primers were homologous to regions 5′ and 3′ of H. ducreyi flp1 and flp3, respectively. PCR of pRSM2832 with P1 and P2 yielded a 2 Kb amplicon that contained the spectinomycin cassette flanked by FRT sites and 50 bp of DNA homologous

to regions 5′ and 3′ of H. ducreyi flp1 and flp3, respectively. This amplicon was electroporated into E. coli DY380 harboring a cosmid size pBeloBAC clone containing the flp operon and flanking DNA. After induction of λ recombinase in this strain, spectinomycin-resistant clones were isolated. One clone was further characterized to demonstrate that the flp1, -2 and -3 genes were replaced with the spectinomycin cassette, with the exception of the flp1 start codon and the terminal 21 bp of the flp3 ORF. The construct was confirmed by sequence analysis. Table 2 Primers used in this study Primer Sequence P1 Crenigacestat research buy TAACCTAAAAAAACAACATAATTTATTTTATATTTGGAGAAAAAGATATGATTCCGGGGATCCGTCGACC P2 GTATATATGGCACATATAAATTATGTGTTTTATAATCTACCTTTATTGAATGTAGGCTGGAGCTGCTTCG P3 CGGTCACGATGGTTCAATGTCT P4 AGCGTTTGACATCATCACCATACT P5 TGCCTACAGCTCAAGTCACGTAA P6 CCACTCGAAAGCGAAACTTGT P7 CATCTCGAGCGCCACACTATCCAC Ralimetinib P8 CACTCTAGATTATAATCTACCTTT P9 GGCTTAATTGCAGTCGCAGTTGCT

P10 GTGCAGCTTTACCTACTCCTCCTT P11 ACTCCGCAGCTGATGCAATGAAAG P12 CAAGCTTATCGATACCGTCGACCT The pBeloBAC clone containing the insertion/deletion mutation in the flp genes was used as a template for PCR. The amplicon containing the insertionally inactivated Etomidate flp1flp2flp3 genes and approximately 500 bp of flanking DNA 5′ and 3′ to the cassette was ligated into the suicide vector, pRSM2072, and then electroporated into 35000HP. Cointegrates were selected by growth on spectinomycin, then resolved by passage on plates containing spectinomycin and 5-bromo-4-chloro-3-indoly-β-D-galactopyranoside (X-Gal) [24]. Allelic exchange was confirmed by colony PCR. To make an unmarked mutant, the plasmid, pRSM2975, which contains a temperature sensitive replicon, a kanamycin resistance cassette, and FLP recombinase under the control of the tet repressor, was transformed into the mutant [9]. Transformants were selected and maintained at 32°C on chocolate agar containing kanamycin. The FLP recombinase was induced to catalyze excision of the spectinomycin cassette resulting in a short unmarked ORF in place of the flp1, flp2 and flp3 genes and the plasmid was cured as described previously [9].