1.43 (Technelysium Pty Ltd). CLUSTAL W [27] and MUSCLE [28] were used to align the nucleotide sequences for comparison; the resulting alignments were inspected, merged and refined manually. RNA isolation and gene expression data analysis Mycelium was collected from the Czapek-Dox medium. Each sample was weighted on laboratory scales (Sartorius). Total RNA was purified using RNeasy

Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturers’ protocol with the additional DNase digestion step. The quality of total RNA was estimated by Nanodrop (Thermo Scientific, Wilmington, DE) and via Bioanalyzer (Bio-Rad, Hercules learn more CA). The primer pairs specific to target gene were designed using zearalenone lactonohydrolase gene sequences obtained from T. aggressivum, C. rosea, C. catenulatum isolates (Table 2). Chk inhibitor Analogously to the DNA sequencing primers, these were designed with use of Primer 3 [24] and their properties were tested using OligoCalc [25]. Table 2 The sequences of the primers used for gene expression Primer Sequences (5′-3′) LACDP723R CAAACGTAGTGACCCTGAAGC LACDP652F CTCGGAGAATGCCAGATGTT rtBtubTRICHOR2 AGCGAATCCGACCATGAAGA rtBtubTRICHOF2 CACCGTCGTTGAGCCCTA The RT-PCR reaction was conducted using SYBR® Green Quantitative RT-qPCR Kit (Sigma-Aldrich). The total reaction volume was 25 μl: 12.5 μl SYBR Green Taq Ready

Mix, 1 μl RNA (< 35 ng), CYT387 mouse 0.5 μl each primer (10 μM), 0.125 μl reverse transcryptase and 5.125 μl nuclease free water. Gene expression profiles were determined through quantitative real-time PCR using a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA). The reaction

was carried using the following protocol: initial denaturation 94°C for 2 min, followed by 40 cycles at 94°C for 15 s, 61°C for 1 min. The melting curve analysis (from 70°C to 95°C) confirmed primer pairs specificity. In the experiment we used three biological and two technical replicates together with a template-free negative control in each analysis of both target and control genes. As a control we used mycelium samples cultivated on medium without addition Branched chain aminotransferase of zearalenone. Relative quantification of gene expression was done using the 2-ΔΔCt method (Bio-Rad, Hercules, CA). All data were normalized to β-tubulin as internal control (Real-Time PCR Application Guide, Bio-Rad, Hercules CA). Mycotoxin chemical analyses Sample preparation The fungal mycelium was grown in 50 ml Czapek-Dox broth (Sigma-Aldrich) with Yeast Extract (Oxoid) for 9 days at 25°C with rotary shaking at 100 rpm. The zearalenone (Sigma-Aldrich) stock was added after a week of incubation. The initial concentration of ZEA in the liquid cultures was 2 mg/ml. The samples (both mycelium and medium) were collected before and after addition of the toxin. During the first day, the samples were collected after one minute, two, four and six hours after toxin application. In the following days the samples were collected once a day at the same time.