The intrachromosomal recombination and plasmid integration are 2-3 orders lower than plasmid recombination, therefore are less concerned. These information help develop Salmonella delivery vectors able to stably maintain plasmid cargoes for vaccine development and gene therapy. Methods Bacterial strains and media E. coli K-12 strain EPI300™ was used for cloning and stable maintenance of plasmids. All Salmonella strains used in this work were derived from Salmonella enterica serovar Typhimurium wild-type (wt) strain
χ3761 (UK-1), serovar Typhi Lonafarnib molecular weight strains Ty2 and ISP1820 or serovar Paratyphi A strain χ8387. Their origin and relevant genotypes are presented in Table 2. Bacteria were grown in LB broth [53]. Plasmid construction All JSH-23 concentration plasmids used in this study and their relevant characteristics are presented in Table 1. Primers used for plasmid construction are shown in Table 6. All enzymes were obtained from New England Biolabs or Promega. Table 6 Primers used in this study Primer Sequencea Directionb P1 tatttctagatttcagtgcaat F P2 ttaggtaccgcgaacgccagcaagacg R P3 taaggtaccccggaattgccagctggg F P4 ttaggatcctccgcgcacatttccccg R P5 taacccgggaattctcatgtttgac
F P6 ttaagatctccatgccggcgataat R P7 tgcttcaacagtacgaattcactatccggttcaataccaagttgcatgacgcatgcctgcagggcgcg F P8 gttttgctgaatggcggcttcgttttgcccgccccaccatcacctgatgattatttgttaactgttaattgtc R P9 ggcaacaatttctacaaaacacttgatactgtatgagcatacagtataattgcttcaacagtacgaa
F P10 gagaaatgccaaaagggccgcataaatgcagcccttgatggtaatttaacgttttgctgaatggcggc R P11 ARS-1620 mw taaactagtacgacagcagagtcctgtaccg F P12 ttaggtacctgaagcttgtcatgcaacttggtattgaac R P13 taaggtaccggatcctcatcaggtgatggtggggcgg F P14 ttatctagatttgcgaacggcctgttcacgt R P15 gatagcacgtgctatcttgtgc F P16 tcgtcgcagacgctgttcgccg R P17 ctagtctagacgtcagtgagaatcagctcaaa F P18 caaggtaccatattagtacattcgtccagg R P19 cgcggtaccagcgctgaacacgttatagacat F P20 acatgcatgcgaatagtcacgacgatatcttt R P21 ctagtctagacgtcagtgagaatcagctcaaaatc F P22 cggggtaccatcaactcataaccagggcgttatc R P23 cgactttatctttacctcgaagctggtggat F P24 gttacggacacggagttatcggcgtgaata R P25 ctagtctagaagattataacgcgctggg Etofibrate F P26 cggggtaccgcgtattatttaccactggtc R P27 cgcggtacctaatcggggcgatttaacaac F P28 acatgcatgccttcgagcgatgaacgctct R P29 gtctataaagcgccggatgagaaacatgtc F P30 tcgacgatcgcttcgagcgatgaacgctct R P31 taaaagcttgaccgcgactgtctgatcgt F P32 tcaagatctctcgggcgcggagttgcccggc R P33 taaagatcttgactgcagtgaaaaagcagtttgccacgat F P34 ttagagctcagaaaggaataccggcatgaca R P35 taaagatctcgatataagttgtaattctc F P36 ttactgcaggcgaggtgccgccggcttcc R P37 ttactgcagtccgcgcacatttccccg R P38 ggggtaatgtcgtggaccatttgc F P39 ccgcggtaatccccggcactaccg R P40 gcgctacaaaccctgtggcaacaat F P41 gctgtgatcgcggacagcaagaatac R P42 ttctcaacataaaaaagtttgtgtaatactgaggatgcggcgtcacag F P43 gttacggacacggagttatcggcgtgaata R a The underlined sequences are enzyme sites mentioned in the text.